Q21 of 30 Page 1

An active member of an awareness group conducts regular programmes to sensitise public against alcoholism amongst youth – a serious health hazard in his locality.

Identify the value this member of the group is trying to propagate amongst the people in his locality.


The value that this member of the group is trying to propagate amongst the people in his locality is to have proper knowledge against commonly abused substances (like alcohol) especially among youth who use it as a gateway to use of other drugs. He wants to make the youth aware of the effects of the alcohol addiction and the harmful effects of drug dependence.


More from this chapter

All 30 →
19

Explain brood parasitism with the help of an example.

 20

Explain the basis on which the get electrophoresis technique works. Write any two ways the products obtained through this technique can be utilised.

 22

In pea plants, the colour of the flower is either violet or white whereas human skin colour shows many gradations. Explain giving reasons how it is possible.

OR


Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it:


UUUAUGUUCGAGUUAGUGUAA


Phe-Met-Phe-Glu-Leu-Val


Write the properties of genetic code that can be and that cannot be correlated from the above given data.


 23

Name the cells HIV attacks first when it gains entry into a human body. How does this virus replicates further to cause immune deficiency in the body?