Q22 of 30 Page 1

In pea plants, the colour of the flower is either violet or white whereas human skin colour shows many gradations. Explain giving reasons how it is possible.

OR


Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it:


UUUAUGUUCGAGUUAGUGUAA


Phe-Met-Phe-Glu-Leu-Val


Write the properties of genetic code that can be and that cannot be correlated from the above given data.


Mendel’s studies on pea plants mainly describe those traits that have distinct alternate forms like the flower color which is either purple or white. But human skin color has many gradations because these traits are generally controlled by three or more genes and are called as polygenic traits. In a polygenic trait, the phenotype shows the contribution of each allele, i.e., the effect of each allele is additive. Let us assume that the three genes A, B, C control skin color in human with the dominant forms A, B, and C responsible for dark skin color while the recessive forms a, b and c for light skin color. The genotype having all the dominant alleles (AABBCC) will have the darkest skin color while the individual with all the recessive alleles (aabbcc) will have the lightest skin color and the genotype with three dominant alleles and three recessive alleles will have an intermediate skin color. This is how it is possible.


OR


The properties of genetic code that can be correlated from the above given data are:


a) The codon is in triplet form: UUU, AUG etc.
b) The codon is degenerate because UUC and UUU are coding for amino acid Phenylalanine.


c) The codon is non-overlapping.


The properties that cannot be correlated from the above given data includes:


UAA the stop codon does not code for any amino acid - codon is ambiguous.


More from this chapter

All 30 →